Pages

हमारी टीम का मानना ​​है कि प्रभावकारी संवाद मानवता की सबसे बड़ी चुनौतियों में से एक है. संवाद में अवरोध कहरबरपा सकता है और विचारों के सुव्यवस्थित और समुचित आदान प्रदान से अच्छे मित्र अर्जित किये जा सकते हैं. हम चाहते हैं आप सब इस प्रयास के लिए ह्रदय से योगदान करें. हम सभी प्रकार की टिप्पणियों, विज्ञान, कला, प्रौद्योगिकी, धर्म, राजनीतिक विचारधाराओं (व्यक्तिगत हमले को छोड़कर) का स्वागत करते हैं. हर व्यक्ति की अभिव्यक्ति की स्वतंत्रता का परम सम्मान किया जाएगा. कृपया व्यक्तिगत हमले और विद्रोहात्मक तेवरों से बचें. हम सब अच्छे लोग हैं..... नहीं है क्या :)


By the way you have to visit ratzcorner to know what is around the corner...for, who else knows the corners better than rats(z)...by all us rats(contributors)

Total Pageviews

Sunday, 11 November 2012

Some useful common tools in higher research (genomics/cell biology) -charts and graphs

One of the main tasks of the researchers is to publish their findings. Charts and graphs become indespensable tools in researh publications. Many times Microsoft excel or similar platforms gives ample options to create mesmerising charts. But at times creating simplified charts become a complicated affair especially if you want to avoid extensive reading and search. There are some easily available templates to create some of the charts where we can do the copy-paste option to create a data

here i am giving a list of available charts, graphs and simple statistical calculation tools available online. Please bear in mind that some of them might have copyright declarations where the authors/publishers need to be aknoledged though all of them are free of any charge. Kindly use your discretion while utilizing the tools.


Plots/Charts

1) Box and Whisker plots


















this types of plots are useful when you are showing variation in the data with respect to a particular parameter. Example of such data is expression of a gene in various conditions.

Where to get it: The template for making this kind of graphs is available at http://www.vertex42.com/ExcelTemplates/box-whisker-plot.html .
The template is available (download now option) at the aforementioned site. The template could be opened in excel/similar format. The various options available are self explanatory at the website. Kindly read the terms of use at the site.



Statistical tests

Disclaimer: I am myself not an expert in statistics. Kindly make an understanding of each of the statistical tests yourselves. These are the tests i found useful in my own studies, only use them with your own discretion. Attempt here is only to make easy availability of online tools, but not on educational aspects.

1) Fisher's Exact Test

this type of tests are most useful in 2 by 2 contigency tables. In simple terms it is useful when you are having a data pertaining to two variables (eg: yes no answers to a question on whether you drink coffee among men and women...total 4 criteria, male, female, yes -coffee, no-coffee but two variables viz. Gender, and answer to question)

Where to get it:  Online tests can be conducted at
http://www.langsrud.com/fisher.htm

the Tab on left panel of the page (below compute option) have 4 columns which needs to be filled by output of 4 criteria. The explanation on operations are available at the webpage concerned.

2) Mann-Whitney U test (also Known as Wilcoxons Rank sum test)

This type of test are most useful when your data is not known to behave in a normal distribution. In simple terms if there is no certainty that the data will follow a certain trend (for example the price of gold on each day of a month is not expected to follow a trend compared to the age of people in a village which will follow normal distribution (the graphical representaton of people of each age will look like a bell - a few persons in lower age group, peak between 20-40 years of age, and again few people above 60 onwards).
In research, expression of genes from tissues/cells may not follow normal distribution and Mann-Whiteny test is useful for this type of results.The expression of a gene x in 2 conditions (say stress and no stress) can be computed for statistical accuracy by Mann-Whiteny U test.

Where to get it:  Online tests can be conducted at
http://elegans.som.vcu.edu/~leon/stats/utest.html

The data pertaining to each of the variable from an excel/similar chart can be directly pasted in the 4th tab (titled data set1 and data set2) and the statistics can be calculated

To be concluded...

Saturday, 10 November 2012

Some useful common tools in higher research (genomics/cell biology) _Primer design

Many times we come across specific tasks in research which needs a specific tool or a specific software. Our best friend google search most often gives us more options than what could be deciphered immediately. Here i will try to introduce a few of the freely available utilities such as softwares and tools useful for academics. Also simple introduction to the functions will be introduced. Please use it with discretion as what suits you most. Kindly acknoledge the corresponding authors in your communications. Here by i am aknoledging the individual providers/developers of the softwares/tools listed below. Copy right infringement, if any, be kindly brought to my notice.

Most of the tools listed below are for Human genome/biology, but may do good also for other applications. But emphasis is on Human biology.

Primer designing.

For PCR-
direct from genomic DNA -exons, introns, UTRs, promoters.

useful links

1) http://www.ncbi.nlm.nih.gov/  - NCBI database
2) http://www.ensembl.org/index.html - Ensembl database
3) http://frodo.wi.mit.edu/ - Primer3 software for primer design
4) http://www.ncbi.nlm.nih.gov/tools/primer-blast/ - Primer BLAST from NCBI for primer design.
5) http://www.operon.com/tools/oligo-analysis-tool.aspx - Tm and complementarity analysis tool


Most of us rely on softwares to design primers. But when it comes to designing good primers which suits us in one go it is almost impossible to predict whether the designed primers will do its job. There are no foolproof methods but you can increase the probability of finding a good primer by following a few steps.

simple steps:

1) Make sure the region for which the primer is to be designed is accurate.
Many times polymorphisms in the primer regions play spoiler. Also some genes have strong sequence similarity between pseudogenes or variants. Make sure that the region for which primers are to be designed is devoid of many polymorphisms.

NCBI database (http://www.ncbi.nlm.nih.gov/) lists all the annotated genes for which sequence can be obtained.
But a more userfriendly database is the Ensembl genome browser (http://www.ensembl.org/index.html) which lists organisms for which sequences are available.

in Ensembl browser  one can simply put the gene symbol (example: ACTB- for beta actin gene) or simply the gene name as you know it.
the search will provide you with a page with matches to the search name and lists 4 subheadings a) domain b) family c) gene 4) transcripts. You can select the gene option

by clicking on the gene you will be provided with the list of organisms for which the gene details are available.
(some times to avoid confusion the genus name is provided eg: fugu for puffer fish)

clicking on the species list will give you again the 4 subheadings a) domain b) family c) gene 4) transcripts
you can again select the gene option here

The genes with similar names will be given. As a word of caution make sure that the gene you are further selecting is exactly the one you are searching for. As an example P53 will give you 204 or so out put, some very similar to P53 but TP53 is what you should go for.

Here you can do a google search for the gene ID provided in the page to make suer it is correct for the organism (specifically from published literature)

On the left tab there will Gene based display- gene summary eg:  http://www.ensembl.org/Homo_sapiens/Gene/Summary?g=ENSG00000141510;r=17:7565097-7590856

Also there will be a gene summary tab below the page, which could be checked for the transcripts coded in the region with exons in blocks. Checking this for the transcript variants will make sure the exons/introns selected are correct - some exons are used only in alternate promoter usage. So exon 2 may be actually exon 1 in a commn transcript. Also it will give us an idea whether the gene is coded in the negative strand in addition to genes upstream or downstream

opt for the sequence

The entire sequence will be provided with exons, 3' and 5' UTRs.

you may select the configure this page option on the left tab to select whether you want to see variations additional exons etc. It is always good to opt for variations ('yes' in variations tab in configure this page) since it helps to design primers from region where there are no known variations (SNPs)

Again to make sure the exon/intron number you are searching for is correct - you may go back to the previous page and see the tab Gene based display- gene summary and select the splice variants (if any)

clicking the splice variants option gives you a new page with graphical representation of absolute position of the transcript and exon used. Also each transcript ID will be available in the Transcripts+ (clicking + will give the trancript information). Search the transcript ID in google to get the correct transcript ID of the gene. Also the mRNA length/protein length will also be useful (simple trick: multiply the protein length with 113 to get approximate protein size in daltons).
the transcripts with CCDS (consensus CDS) numbers are well annotated transcripts and possibly is what you are looking for. Again going to the sequence page you can select the exon or intron or region of interest, copy it to an MSword or similar document. Make sure that flanking sequences, atleast 100 on each sides, are selected.

After selecting the region of interst

If your aim is the sequence the exons from patient/specimen samples make sure you are adding ~50 bases on either side of the target sequence, especially from intron. The sanger sequencing is unreliable to first 30-50 nucleotides from start. Bidirectional sequencing is intended. Also this approach will give you information on whether splice sites are affected (-10 nucleotides upstream of exon start and +10 nucleotides after the end of sequence)


method-1
Now

1) select the entire region and paste it in the Primer3 software http://frodo.wi.mit.edu/ available free online.
select the mispriming library on top of the tab (3 organisms available) if any or leave it none.

2) click both left and right primers tab

3) Leave every settings as it is and click pick primers

Now it will give you the primers in the region...if no primers are available the reasons will be listed.

This is not the task finished but a prelude to whether there are acceptable primers in the region. Some regions are repeat heavy/ or high GC rich which will not give primers in the region.

Now go back to the word document

put square brackettes ([ ]) immediately outside targetted region (including whole exon , and 30-50 nucleotide upstream and downstream of the exon region of interest). The aim of this task is that primer3 will not include the region in brackettes to select primers and only flanking primers to the brackettes will be selected.

eg: GCATTGTAGTCTTCCCACCTCCCA[GATGGCGGAGGGCAAGTAGCAAGGGGGCGGGGT
GTGAAGCACTCAGTTGCCTTCTCGGGCC]TCGGCGCCCCCTATGTACGCCTCCCTGGGCTC
GGGTCCGGTCGCCCCTTTGCCCGCTTCTGTACCACCCTCAGTTCTCGGGTCCTGGAGCAC
CGGCGGCAGCAGGAGCTGCGTCCGGCAGGAGACGAAGAGCCCGGGCGGCGCTCGTACTTC
in above example i am searching for primers outside the square brackettes.


out put is as:

GCATTGTAGTCTTCCCACCTCCCAGATGGCGGAGGGCAAGTAGCAAGGGGGCGGGGTGTG
   >>>>>>>>>>>>>>>>>>>>>**************************************

   61 AAGCACTCAGTTGCCTTCTCGGGCCTCGGCGCCCCCTATGTACGCCTCCCTGGGCTCGGG
      *************************                                  

  121 TCCGGTCGCCCCTTTGCCCGCTTCTGTACCACCCTCAGTTCTCGGGTCCTGGAGCACCGG
                 <<<<<<<<<<<<<<<<<<<                             

  181 CGGCAGCAGGAGCTGCGTCCGGCAGGAGACGAAGAGCCCGGGCGGCGCTCGTACTTC



note that the starred sequence is what we gave inside the brackettes and primers were chosen outside the starred region.


now put back the entire sequence with brackettes to the primer3 tab.

select the product size range, say 450-500 (should keep a flexible range not a single number) remove all other default ranges. Go for the minimum but essential range (for an exon of 300 bp with added flank 50 on either side -totaling 400 bp (now in brackettes) a range of 400- 450 will do) remember that the smaller the product size the higher the chances of PCR success.

then move below the page: Go to General Primer Picking Conditions.
primer size :
Put the primer size range as per your need (usually minimum - 18 bases, optimum (opt) - 22 bases, max (maximum) - 26 bases. The programme will try to give you optimum results but if it cannot find one it will use the min and max ranges.

product tm :

care should be taken here. For normal sequence, optimum tm is around 54-60 degree. But if your sequence is GC rich it could go way high and if it is AT rich it might be lower. Also try to design all the primers you use to have a small range of optimum Tms. This way all your PCRs can run at a common annealing temperature and it is easier to standardize the primer. This will free you of the task of amplifying each target in one PCR machine at a time, all your PCRs can run at a time in one PCR. I try to keep the Tm close to 58-60 so that all my PCRs can run with same annealing temperature later. Go for higher or lower Tm only if your sequence is troublesome.

min- 54 opt 57 max 62 is a good option. But decide carefully depending on your sequence. Promoter sequences or GC rich sequence may require higher max Tm

Leave all other options at default setting.

and click pick primers.





















Here you have to check  a few things

Product size, Tm of primers, primer complementarity (should be the minimum possible so repeat this exersize with changed parameters such as region in brackettes, Tm etc). also note where the primers are sitting in the original sequence.

additional primers are also provided in the same page so that you may opt for another pair.


Method-II

A much more simpler way of primer design is the NCBI PrimerBLAST http://www.ncbi.nlm.nih.gov/tools/primer-blast/.

This works almost the same way as that of the method-I. It is much more simpler with userfriendly options. Being comparatively new, i used this method sparingly  but i have got feed back from users saying it works perfectly fine. The user interface is much more simpler than Method-I though the output format is a bit clumsy than the Primer3 software.





(To be concluded)

Sunday, 13 November 2011

Yoga for every day...special for fast& stressful life (1) Pachimottanasana

Yoga
Yoga is a physical, mental, and spiritual discipline, originating in ancient India. The goal of yoga, or of the person practicing yoga, is the attainment of a state of perfect spiritual insight and tranquility. Yoga is good for everybody.
Patanjali, ancient indian saint described  “Astanga Yoga” which  consists of eight following limbs -
  1. Yama (The five "abstentions"): non-violence, non-lying, non-covetousness, non-sensuality, and non-possessiveness.
  2. Niyama (The five "observances"): purity, contentment, austerity, study, and surrender to god.
  3. Asana: Literally means "seat", in particular postures.
  4. Pranayama ("Suspending Breath"): Prāna, breath, "āyāma", to restrain or stop.
  5. Pratyahara ("Abstraction"): Withdrawal of the sense organs from external objects.
  6. Dharana ("Concentration"): Fixing the attention on a single object.
  7. Dhyana ("Meditation"): Intense contemplation of the nature of the object of meditation.
  8. Samādhi ("Liberation"): merging consciousness with the object of meditation.
In ancient days, students will be taught to practice good behavior (Yama; Sadachar).
Next, in yoga, we need to fill our body with air, so it’s necessary to clear our body from all bodily excretory waste products (Niyama). We practice cleaning nose, ear, stomach etc through several means and also practice Nadi-shodhana so that our body could be filled with more air.
After this, the students are advised to practice “Asana”. After the body gains flexibility and is apt with most of the asanas, students are advised to do pranayams (Asanas with breathing control) and slowly higher forms of yoga.

In todays world, we donot have much time to devote and it is virtually not possible to follow all the Yama and niyama in day to day life. In regular yoga classes people are directly taken to 3rd step that is to do “Asanas”.

Preparations before doing yoga.
It is better to do yoga in the morning time. If it is not possible then choose your suitable time like in the evenings etc. Ensure that the stomach is empty. Donot do asanas after taking food. Go to toilet and clean colons, clean nose and wash face. That is why its better to do yoga in the morning after getting up and before taking your breakfast. After doing yoga, go to toilet to remove any waste coming out of body but donot bath immediately, take after 30 mins. Take some food after doing yoga, since you might feel hungry after doing these exercises.

Which yoga to do?
Based on ur need and body flexibility, u can choose right asanas for your body. There is no need to do all asanas in a day. U may do 3-4 asanas in a day and may do them alternatively. If you need to cure some problem, do the corresponding asanas for a more time and do other asanas for a less time.

Paschimottanasana


Paschimottanasana
Keep a carpet or blanket on the floor (See above picture). Sit on it keeping ur legs fully relaxed in front, keeping two legs side by side touching each other. Slowly, side wise raise two hands fully expanded above your head. Slowly bend (lean) forward bending and try to touch your feet. Initially you will not be able to easily touch ur feet but slowly with daily practice, body gains flexibility. Stay in the posture for 1 minute and with a gap rest of 1 minute repeat 3-5 times. In case of therapeautics, you can stay for more time, with simple breathing. Come back to normal position after yoga and get on with the fast life as usual. Can be practiced by either gender, children or aged.

Benefits - Its good for digestion, constipation and helps decreasing the increasing belly (abdominal fat). Therapeutic for high blood pressure.

For further reading please follow this LINK

Acknoledgements: Wikipedia

Saturday, 29 October 2011

Monday, 24 October 2011

Heriditary colorectal cancers (India)

1. Hereditary Non Polyposis Colorectal Cancer (HNPCC)

HNPCC is a familial syndrome. It essentially means that the probability that one will get some type of cancers (Colon cancer, Rectal cancer, Endometrial cancer, Gastric cancer mainly) is enhanced by several fold higher than a normal person if these type of cancers run in their families for successive generations.

As per the guidelines set by the experts (based on decades of research) one should have a genetic consultation if he/she has

a. Cancer at a relatively young age 

most cancers in general and colorectal cancer in particular is a disease of elderly i.e >60 years of age. If you have colorectal cancer below 50 years of age while having a healthy life style, chances are that you might have inherited it from parents. This does not necessarily mean that you have a familial cancer but it is a point to suspect so.

b. You have a family member who suffered or is suffering from cancer

one of the main aspect of hereditary cancer is that they have repetitive nature with respect to relatives. If any of your close blood-relative suffered or is suffering from cancer (mainly Colon cancer, rectal cancer, Endometrial cancer (cancer of the lining of uterus (not cervical cancer which is far more common)) and gastric cancer) and you too suffer from colorectal cancer, you should suspect a familial nature to your disease. 

c) You have cancer which is in the right colon.

HNPCC typically has more propensity to have cancers in right colon. If you have cancer in the right colon at the same time has any other factor such as a relative with cancer or you are young, there is a possibility that it is HNPCC.


What should you do if you suspect you have Familial cancer.

There is some relieving information...HNPCC patients tend to have better outcomes than the non HNPCC colorectal patients. There are specific and widely accepted diagnostic tests (viz. Microsatellite Instability or MSI testing) to identify whether your cancer belongs to HNPCC type.

The bad news is that such tests though relatively simple, are not widely available in India outside research laboratories. In my knowledge only 2-3 laboratories in India conduct the MSI testing that too for research purpose. 

The main reason, i beleive, that MSI testing is not commercially available is that HNPCC is comparatively rare (6-10% of total colorectal cancer from west, FREQUENCY UNKNOWN in India). As such Colorectal cancer is relatively less (compared to breast cancer, cervix, tongue cancer etc) and HNPCC being a miniscule percentage of this, economies of scale cannot be acheived. Though the tests are simple, the necessary equipments are quite costly for diagnostic laboratories.

In my rough estimate the entire test should not cost more than Rs. 3000 for the MSI testing if it were available commercially.

But one can of course consult their clinicians so that they could send their samples (info given below) to the research laboratories ( i will be updating the list of laboratories performing such tests). There are currently some issues with this format. one is that  none of the government run laboratories (where research is done) are authorised to give a service of this kind (from possibly ICMR/IMA/drug comptroller of India etc), hence a fee based service cannot work. There are a few government run research and diagnostic laboratories (my parental organization CDFD is one among them) authorised to give molecular diagnostics services. But most of them are not conducting the MSI testing either due to lack of skilled manpower in the diagnostic divisions or due to the lack of people seeking such services. But i am very hopeful a couple of them might come up in very near future on fee-based service.

This directs one to a research based service.

This means you are a volunteer to a research (fortunately atleast 3 teams in India are researching on familial cancers i will update a list soon).

1) Dr. Devendra Desai -Consultant Gastroenterologist, DNB (Gastroenterology), MD (Gen Med), MBBS - PD Hinduja Hospitals, Mumbai.

2) Dr. T Rajkumar -SCIENTIFIC DIRECTOR, MOLECULAR ONCOLOGY, WIA Cancer Institute, Adayar, Chennai.

3)Ravindran Ankathil, Ph.D - Regional Cancer Centre, Trivandrum.
http://rcctvm.org/raviankathil.htm


Your clinician will have to guide you through this. 
You have to give a consent form clearly stating that you are aware of what research you are volunteering, and you cannot claim monetary or any other benefits from the research outcome. You have to also affirm that you didnot undergo any procedure solely for the research (that is the research is to be done on biopsy/resection performed by your hospital to your cure earlier in the hospital). Normally good hospitals preserve the tissue specimen in paraffin blocks (which is called FFPE blocks) and one can access those specimen for years. The MSI testing is heavily dependent on these blocks and how well they were prepared. so if the hospital procedures are not good it might fail. upto 2-3 years post surgery the blocks could be used for MSI (provided the preparation of blocks were good). Your clinician will have to send the blocks corresponding to the TUMOR and NORMAL margin.
Since the research laboratories are not bound by any legal necessities to give you any feed back at all, you cannot ask them to perform the tests and give it in a stipulated time. It has to be solely based on request and not by authority. 
I agree that this is a sad state of affairs, but that is all what one can do. But believing in positive side of humanity one can expect the results in 2-3 weeks, if the researchers agree. The researchers will surely want your family inheritance profile, and they would want you to consent for the data to published in public domain (at the same time keeping your details to identify you anonymous)

Also please be advised that there are no legal framework or guidelines for such a methodology yet. the researchers are bound by ethical rules which states that the volunteers cannot be lured for any sort of benefit at all (and the result of testing may be construed as a benefit). Also privacy of medical aspects of volunteers is absolute must in research, and revealing them is criminal offense (secrecy of information clause). So if you are heading this way clearly understand the complications in such mode, and be patient and tolerant to the research teams.

What next if you know you could get MSI testing done

An MSI test positive (in technical jargon MSI-High) indicates that there is high probability of a family history of tumor of HNPCC type. But this test doesnot confirm that you have HNPCC cancer. Yet  the result of MSI has its own implication. This will indicate (if you are lucky enough to get the results in time) that you may have to be treated differently unlike other colorectal patients. Unfortunately here again many clinicians are unaware/unsure of the molecular approach to therapy. But there are  quite a few who are well versed in this approach and many tertiary centres have dedicated clinicians for molecular therapy. Also this could mean that you have a better chance of surviving cancer than others with colon cancer. Also since HNPCC is familial your immediate relatives can be advised to be cautious for any signs of cancer or to undergo consultation with doctors in regular intervel (mind you MSI will not confirm the familial nature, but you could be safe than sorry). Recurrence in same patient is also common so be a more vigilant on these aspects and may alter unhealthy lifestyle.

To confirm the MSI testing a rather elaborate procedure is to be performed. There are diagnostic markers (typically Immunohistochemistry) which  can identify the faulty gene (inheritance factor) which triggered your tumor initiation. Once the gene is identified, gene sequencing from your blood can be performed to pinpoint the region where the gene is faulty (which is referred as mutation). if you could identify the faulty region of the gene, by gene sequencing you can confirm that you have HNPCC

These last methods are typically very costly and as per my estimate the first time confirmation of HNPCC might cost you atleast 20-30 thousand rupees. But if you are volunteer in a research project you may get to know the mutation free of cost, but as i mentioned above, there is no guarantee that your mutation will be identified nor is it a great way to go.  

What if you come to know you are HNPCC patient

As a disclaimer i will forewarn you that knowing own fate is not a pleasing experience. Nothing can be done to correct the faulty genes in your body (with the current technology, though in distant future such methods might be developed). But so is the case if you had only one functional kidney or you had AMD (a degenerative disease with progressive loss of vision). But keeping a positive life to what ever available makes a difference. By knowing that you are HNPCC patient you are just informed about a proability of you to develop cancer and not a certainty. It infact helps you by which you can have your efforts to stay cancer free. Each and every one has a probability to develop cancer and it is only that you have a bit more probabilty. It is like if you are a driver...every traveller has a chance to die of accident but a regular driver has more chance.

If you come to know you are an HNPCC patient that implies that your relatives are also having risk of cancer so is the case with your children or next generation. But by knowing that you have HNPCC you can be cautious with your health and be watchful for any signs of cancer. You can also get your relatives checked for the presence of faulty gene and who ever inherited the faulty gene could be advised to be cautious and to undergo annual colon checkups. Such checks can identify any dangerous development early, and early identification is the best available way for fighting cancer. Also different treatment could be opted if unfortunately any of relatives develop cancer. A healthy lifestyle habit can keep cancer to some extend at bay.

Familial cancers tend to strike very early in life i.e 20-30 years. Loss of life at this age will be traumatic for the rest of family members. But screening may be helpful in identifying cancers early (and could be cured completely by surgery). The risk of developing cancer is quite high in HNPCC if you inherit a faulty gene (50-80% of the persons inheriting the faulty gene might develop cancer, depending on the nature of mutation)

But from a common man's view point HNPCC is nothing specifically bad. Every human is destined to die and ones natural death is largely dependent on the inheritance. Almost all of us have  one or the other faulty genes (ranging from simple vitiligo (patchy white areas in skin) to diabetics to cancer). So if you have cancer donot be depressed that you are cursed, but be informed that you have a little bit severe defect than others (i.e none are holier than thou). 


Also as a molecular biologist i will like to assure you that molecular medicine is undergoing revolutions. In future we may have cures also available.

If you or any one of your relative is suffering from HNPCC or Colorectal cancer I wish you speedy recovery and a cancer free life for rest of life.

If you have any comments, suggestion or queries please do put it up to me...I can try to help you with whatever limited knowledge i have in this.

regards,
Ratheesh. R
Laboratory of Molecular oncology
Centre for DNA Fingerprinting and Diagnostics
Hyderabad.